| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Brief Communication |
Correspondence: 1 Corresponding Author: Elizabeth A McNiel, Department of Veterinary Clinical Sciences, University of Minnesota, 1352 Boyd Avenue, Saint Paul, MN 55108, mcnie001{at}umn.edu
 |
Abstract |
|---|
 TOPSources and manufacturers Abstract References |
|---|
Key Words: Amelogenin • cattle • chimera • cytogenetics • freemartin • PCR
A freemartin is an infertile female heifer that is born with a male twin and demonstrates incomplete development of the genital tract. Arrest of the female reproductive tract development in utero results from humoral factors that derive from the male co-twin through conjoined chorionic blood vessels.8 Freemartins are chimeric animals having cells with an XX karyotype, characteristic of females, as well as cells with an XY karyotype, characteristic of males. Cytogenetic analysis of cultured lymphocytes has been traditionally used to identify XY cells in suspected freemartins. Cytogenetic testing is thought to be 95%–99% accurate when 100 mitotic cells are studied.2 In addition, cytogenetic analysis for freemartinism allows detection of other reproductive problems, such as chromosomal centric fusions.1, 10, 11 However, there are limitations to cytogenetic testing. For instance, male cells may be few in number, requiring evaluation of hundreds of cells for a definitive diagnosis.2 Furthermore, cytogenetic testing requires extremely careful collection and handling of samples, is labor intensive, and requires cytogenetics expertise that is not readily available at most diagnostic centers.
Polymerase chain reaction (PCR) based testing has been explored as an alternative to cytogenetic examination for the detection of freemartinism.3–7, 9 One such technique, described by Ennis and Gallagher, is based on a polymorphism associated with the bovine amelogenin gene (AMX/Y).10 The AMX/Y allele residing on the Y chromosome contains a 63-bp deletion in the fifth exon when compared to the AMX/Y allele residing on the X chromosome. A PCR technique based on amplification of the region of AMX/Y containing this deletion uses a single primer pair to amplify a 280-bp fragment from the X chromosome and a 217-bp fragment from the Y chromosome.3 Because a freemartin carries both XX and XY cells, this PCR technique can be used in the diagnosis of this condition. Although a variety of PCR-based techniques can be used for sexing cattle, an advantage of this technique is that a single pair of oligonucleotide primers is used to amplify both the AMX and AMY alleles; thus PCR failure cannot be mistaken as a negative test result for freemartinism.10 Yet the competitive nature of this assay could limit its sensitivity. Reports of the use of PCR, including AMX/Y amplification, for detection of freemartinism are limited to a few animals. Thus our objective was to modify PCR-based detection of the AMX/Y polymorphism for use in our laboratory and to compare it with conventional cytogenetic analysis in a diagnostic setting.
The primary modification of the PCR technique involved the use of separated lymphocytes in lieu of whole blood in the PCR reaction. Lymphocyte count and blood sample quality can vary considerably in clinical samples; therefore, concentrated lymphocytes or isolated DNA make more appropriate substrates than whole blood for a small-volume PCR-based assay. Low lymphocyte counts in whole blood could be insufficient to detect an XX/XY chimera with very small numbers of XY cells. It is important that thousands of lymphocytes be included in each PCR reaction, because infertility is reported in XX/XY chimeric cows in which the ratio of male to female cells is as low as 1:100. In our hands, lymphocyte separation was less expensive and less labor-intensive than DNA isolation; thus, separated lymphocytes were used as the substrate for PCR.
Blood samples were stored at 4°C for no more than 10 days before lymphocyte preparation. Whole blood was diluted 1:1 with 0.9% NaCl and layered on top of Ficoll-Paque PLUSa (2 volumes diluted blood to 1 volume Ficoll-Paque). The sample was centrifuged at 400 g for 30 minutes in a clinical centrifuge, and the lymphocyte layer was removed for PCR analysis. Four µl of the isolated lymphocyte suspension was added to 10 µl water. This suspension was subjected to 3 cycles of heating (100°C for 3 minutes) and cooling (55°C for 3 minutes) and then was maintained at 4°C. Polymerase chain reaction reagents (1x PCR Master Mixb and 0.2 µM (final) each of forward and reverse primer oligonucleotidesc (SE 47 5' CAGCCAAACCTCCCTCTGC and SE 48 5'CCCGCTTGGTCTTGTCTGTTGC)) were added to yield a final volume of 50 µl. The PCR reactions were carried out in a Hybaid thermocycler.d Samples were initially denatured at 97°C for 3 minutes, then subjected to 35 cycles of denaturation (94°C for 1 minute), annealing (temperatures evaluated ranged from 45°C to 65°C for 1 minute), and extension (72°C for 1 minute). A final extension step was performed at 72°C for 10 minutes, after which the samples were cooled and maintained at 4°C.
Polymerase chain reaction products were evaluated using agarose gel electrophoresis (1.5% agarosee gel in Tris-Borate-EDTA) (0.045 M Tris-Boratef, 0.001 M EDTAf). The gel was visualized under UV light for X chromosome (AMX; 280 bp) and Y chromosome (AMY; 217 bp) amelogenin gene PCR products based upon comparison with a standard DNA ladder.g Discrete bands corresponding to the size of the AMX and AMY amplification products were obtained for annealing temperatures ranging from 55°C to 70°C (Fig. 1A, 1B). In addition to bands corresponding to AMX and AMY products, a band representing a more slowly migrating heteroduplex of AMX and AMY products was also evident in samples from bulls. There was also evidence of significant primer dimer formation, which results from high complementarity between the oligonucleotide primers. However, these bands were distinct from the AMX and AMY bands. The effects of annealing temperature on PCR products obtained from mixed suspensions of bovine lymphocytes containing 1% XY cells (99% XX) were also investigated, since 1% is the limit of detection of our standard cytogenetic protocol. As with the bull lymphocytes, nonspecific bands were identified at annealing temperatures below 55°C. At higher temperatures, up to and including 65°C, there was adequate amplification of the AMX and AMY products (Fig. 1C).
|
|
Of the 73 samples submitted, 17 samples failed to yield analyzable mitotic spreads for cytogenetic analysis, probably as a result of poor sample quality. Fifteen of these samples were analyzable using PCR. Two samples failed to yield diagnostic results using either PCR or cytogenetic testing. Again, we suspect that sample quality issues were involved in the PCR failure. Thus, all cases that could be evaluated using cytogenetic techniques were also suitable for PCR testing. For the 56 samples that were suitable for evaluation using both PCR and cytogenetics, there was 100% concordance between the 2 tests. Fifty of these heifers were diagnosed as freemartins, and 6 were diagnosed as normal heifers. For the remaining 17 samples, which could not be assessed using cytogenetic analysis, PCR testing established 11 animals as freemartins and 4 as normal heifers.
To the authors' knowledge, this study comparing a PCR-based detection of freemartinism with cytogenetic evaluation involves a larger number of cases than previous reports. The data indicate that PCR-based testing is more likely to achieve a diagnostic result, even on samples that fail to yield analyzable chromosome spreads following culture. Cytogenetic testing is much more technically difficult, time-consuming, and dependent on sample handling. Ambient temperatures during storage and shipping may adversely affect the ability to culture lymphocytes, whereas these issues would be less likely to affect simply recovering cells (or DNA) for PCR. Bacterial contamination of blood and culture media is also a potential pitfall that is less likely to affect PCR.
The PCR-based assay is more sensitive than cytogenetic evaluation, although limited to the detection of no less than 1 in 500 cells. The competitive nature of this PCR assay and perhaps the use of cells instead of isolated DNA could be responsible for limiting the sensitivity. The clinical relevance of detecting small numbers of XY cells much below 1 in 500 is questionable. The authors are unaware of reports suggesting that such animals exist or are infertile.
It is important to consider that PCR is not without limitations. Exclusive use of PCR in the evaluation of cattle would allow for other cytogenetic abnormalities that may significantly impact fertility to be missed.10 It is also possible to conceive of genetic abnormalities that could lead to false inaccurate results. We would expect such events to be rare. In conclusion, PCR-based amplification of bovine amelogenin gene in the region of a sex-specific polymorphism offers an effective means of identifying freemartins.
|
Sources and manufacturers |
|---|
|
TOPSources and manufacturersAbstractReferences |
|---|
a. Amersham Biosciences Corporation, Piscataway, NJ.
b. Eppendorf, Hamburg, Germany.
c. Advanced Genetic Analysis Center, University of Minnesota, St Paul, MN.
d. Thermo Electron Corporation, Woburn, MA.
e. Invitrogen Corporation, Carlsbad, CA.
f. Sigma-Aldrich Corporate Offices, St. Louis, MO.
g. New England Biolabs Incorporated, Beverly, MA.
h. Biowhittaker Incorporated, Walkersville, MD.
i. Summit Biotechnology, Fort Collins, CO.
j. ICN Biomedicals, Aruora, OH.
k. Cellgrow, Mediatech, Herndon, VA.
|
References |
|---|
|
TOPSources and manufacturersAbstractReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. Citek, J. Rubes, and J. Hajkova Short communication: Robertsonian translocations, chimerism, and aneuploidy in cattle J Dairy Sci, July 1, 2009; 92(7): 3481 - 3483. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
