JVDI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Veterinary Diagnostic Investigation Vol. 18 Issue 5, 513-515
Copyright © 2006 by the American Association of Veterinary Laboratory Diagnosticians
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saunders, G. K.
Right arrow Articles by Thomsen, B. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saunders, G. K.
Right arrow Articles by Thomsen, B. V.

Brief Communication

lymphoma and mycobacterium avium infection in a ferret (Mustela putorius furo)

Geoffrey K. Saunders and Bruce V. Thomsen1

Correspondence: 1 Corresponding Author: Geoffrey K. Saunders, College of Veterinary Medicine, Virginia Tech, Blacksburg, VA 24061.


    Abstract
 TOP
 Sources and manufacturers
 Abstract
 References
 
A 6-year-old, neutered male ferret presented with weight loss. Radiography revealed an enlarged liver and other abdominal masses. The ferret was euthanized, and at necropsy, the stomach wall was thickened, mesenteric lymph nodes were enlarged, and the liver contained multifocal tan nodules. Histopathology confirmed lymphoma and granulomatous inflammation in all affected organs. Acid-fast bacilli were present in the lesions and were confirmed to be Mycobacterium avium by PCR.

Key Words: Ferret • lymphoma • Mycobacterium avium

Lymphoma is a common disease of the ferret and most often affects spleen, liver, lymph nodes, kidneys, and lung.2,7 Ferrets are susceptible to a variety of different mycobacterial infections, and the most commonly reported infections are caused by Mycobacterium bovis and M. avium.1,5,8,12,13 Mycobacterial infections typically are thought to result from eating contaminated feed.1,12

A 6-year-old, neutered male ferret presented to the veterinarian with weight loss. A complete blood cell count revealed a leukocytosis (20 x 103/µl; normal, 5–10 x 103/µl) of which lymphocytes comprised 75% of the cells (15 x 103/µl; normal, 1.5–8 x 103/µl). The ferret was anemic, with a red blood cell count of 4.75 x 106/µl (normal, 8.3–10.2 x 106/µl). Radiographs of the abdomen showed an enlarged liver and a mass in the left cranial abdomen, caudal and dorsal to the stomach. The spleen appeared to be wrapped around the mass but not enlarged. Based on a preliminary diagnosis of multicentric neoplasia, the ferret was euthanized.

At necropsy, the stomach wall was thickened to 2 mm, causing prominent folds on the mucosal surface. The liver contained multiple tan nodules of approximately 0.5–1 cm in diameter. Mesenteric lymph nodes were enlarged approximately twice normal size and were replaced by tan tissue, with no clear distinction between the cortex and the medulla.

Stomach, mesenteric lymph nodes, liver, kidney, and lung were examined microscopically. Within the stomach, mesenteric lymph nodes, and the liver was a mixture of neoplastic cells and granulomatous inflammation. Frequently, foci of neoplastic cells were intermixed with areas of granulomatous inflammation. The stomach had a transmural infiltrate of neoplastic lymphocytes and granulomatous inflammation that obliterated the normal architecture (Figs. 1, 2). Mesenteric lymph nodes were effaced by similar infiltrates of neoplastic lymphocytes and granulomatous inflammation. The liver had numerous foci of granulomatous inflammation and neoplastic lymphocytes. The granulomatous inflammation consisted of diffuse accumulations of macrophages, with abundant lightly eosinophilic cytoplasm. A Ziehl-Neelson stain revealed numerous acid-fast bacilli within the macrophages (Fig. 3). A few small aggregates of macrophages were seen in the renal cortex and pelvis, and these cells contained many acid-fast bacilli. The lungs were normal, but the alveolar macrophages contained acid-fast bacilli.


Figure 18052101
View larger version (195K):
[in this window]
[in a new window]
 
Figure 1 Stomach; ferret. Granulomatous inflammation in the submucosa (asterisk) and lymphoma beneath. The mucosa (top) is mostly unaffected. HE. Bar = 100 µm.

 

Figure 18052102
View larger version (173K):
[in this window]
[in a new window]
 
Figure 2 Stomach; ferret. The cell morphology of the neoplastic lymphocytes is shown within the mucosa. HE. Bar = 25 µm.

 

Figure 18052103
View larger version (177K):
[in this window]
[in a new window]
 
Figure 3 Stomach; ferret. Acid-fast bacilli are numerous within macrophages of the mucosa. Ziehl-Neelsen acid-fast. Bar = 50 µm.

 
The neoplastic cells within the stomach, mesenteric lymph nodes, and the liver were large round cells, 30–50 µ in diameter, with marked anisocytosis, and a moderate amount of eosinophilic cytoplasm, with distinct cell borders. Nuclei were large, oval, and irregular, with prominent anisokaryosis and a moderate mitotic rate (1–3 mitotic figures/high power field). Few giant nuclei and multinucleated cells were seen. Nuclei had stippled chromatin or were vesicular and contained single or multiple small nucleoli. Mitotic figures were numerous. The neoplasm was diagnosed as a lymphoma and classified as a diffuse large cell type following the National Cancer Institute's working formulation for non-Hodgkins lymphomas.11

A PCR test was performed on the formalin-fixed, paraffin-embedded tissue by using primers for IS6110 to identify M. tuberculosis complex species, 16S rRNA to identify M. avium species, and IS900 to identify M. avium subspecies paratuberculosis. The procedures were similar to those described previously.10 The M. avium primers (5' AGAGTTTGATCCTGGCTCAG and 5' ACCAGAAGACATGCGTCTTG) gave a positive test result, as evidenced by an appropriately sized amplification product after gel electrophoresis. PCR testing was negative for M. tuberculosis complex species and M. avium subspecies paratuberculosis.

The lymphoma in this ferret had a fairly typical organ distribution for this disease, except in the stomach, which was more involved than other organs. Infection with Helicobacter mustelae has been implicated as a cause of gastric lymphoma in the ferret, and this could explain the preferential involvement of the stomach.3 However, no helicobacteria were detected with Steiner silver stain in this case. Lymphoma has been induced experimentally in ferrets by the feeding of cells or cell-free tissue-culture supernatant fluid from a ferret lymphoma.4 Cultivated cells from the affected ferrets demonstrated reverse transcriptase activity and retrovirus-like particles, supporting a viral cause for lymphoma in ferrets. Examination for viruses was not done in this ferret.

Ferrets are susceptible to a number of mycobacterial infections, including M. avium, M. bovis, M. genavense, M. microti, and M. celatum.8,9,1214 Mycobacterium bovis is probably the most important cause of mycobacteriosis in ferrets, and ferrets appear to be less susceptible to M. avium than to M. bovis.1 Ferrets are an important wildlife reservoir of M. bovis in New Zealand, and prevalence rates for tuberculosis in feral ferrets are as high as 32%.9 Ferrets with tuberculosis have been implicated in the transmission of M. bovis to both man and domestic livestock.1,6 Histopathology can be helpful in differentiating M. avium from M. bovis in ferrets, but culture and/or PCR are needed for a definitive diagnosis.

The lesions caused by M. bovis in this ferret, and in a previous report, were characterized by sheets of macrophages filled with large numbers of acid-fast bacilli.12 In contrast, the lesions caused by M. bovis are more variable and composed of discrete aggregates of epithelioid macrophages, with or without focal areas of necrosis, and the macrophages contained variable numbers of bacteria.1,9 Giant cells and foci of mineralization, which are common key histologic features of M. bovis in other species, were not observed in the ferret lesions.9

The mycobacterial infection in this ferret was widely disseminated and found within stomach, mesenteric lymph nodes, liver, kidney, and lung. Infections concentrated within the gastrointestinal tract are suspected to be caused by oral ingestion of feed contaminated with Mycobacteria.1,12 Immunosuppression has been implicated as a cause of some mycobacterial infections in ferrets.8 The lymphoma in this case could have caused immunosuppression, thus predisposing the ferret to mycobacterial infection.


    Sources and manufacturers
 TOP
 Sources and manufacturers
 Abstract
 References
 
From the College of Veterinary Medicine, Virginia Tech, Blacksburg, VA 24061 (Saunders), Pathobiology Laboratory, National Veterinary Services Laboratories, 1800 Dayton Ave, Ames, IA 50010 (Thomsen). Back


    References
 TOP
 Sources and manufacturers
 Abstract
 References
 

  1. Cross M.L., Labes R.E., Mackintosh C.G.: 2000, Oral infection of ferrets with virulent Mycobacterium bovis or Mycobacterium avium: susceptibility, pathogenesis and immune response. J Comp Pathol 123:15–21.[Medline]
  2. Erdman S.E., Li X., Fox J.G.: 1998, Hematopoietic diseases. In: Biology and diseases of the ferret, ed. Fox J.G., 2nd ed., pp. 231–246. Williams and Wilkins, Baltimore, MD.
  3. Erdman S.E., Correa P., Coleman L.A., et al.: 1997, Helicobacter mustelae-associated gastric MALT lymphoma in ferrets. Am J Pathol 151:273–280.[Abstract]
  4. Erdman S.E., Reimann K.A., Moore F.M., et al.: 1995, Transmission of a chronic lymphoproliferative syndrome in ferrets. Lab Invest 72:539–546.[Medline]
  5. Fox J.G.: 1998, Bacterial and mycoplasmal diseases. In: Biology and diseases of the ferret, ed. Fox J.G., 2nd ed., pp. 343–347. Williams and Wilkins, Baltimore, MD.
  6. Jones J.W., Pether J.V., Rainey H.A., et al.: 1993, Recurrent Mycobacterium bovis infection following a ferret bite. J Infect 26:225–226.[Medline]
  7. Li X., Fox J.G., Padrid P.A.: 1998, Neoplastic diseases in ferrets: 574 cases (1968–1997). J Am Vet Med Assoc 212:1402–1406.[Medline]
  8. Lucas J., Lucas A., Furber H., et al.: 2000, Mycobacterium genavense infection in two aged ferrets with conjunctival lesions. Aust Vet J 78:685–689.[Medline]
  9. Lugton I.W., Wobeser G., Morris R.S., et al.: 1997, Epidemiology of Mycobacterium bovis infection in feral ferrets (Mustela furo) in New Zealand: 1. Pathology and diagnosis. NZ Vet J 45:140–150.
  10. Miller J.M., Jenny A.L., Payeur J.B.: 2002, Polymerase chain reaction detection of Mycobacterium tuberculosis complex and Mycobacterium avium organisms in formalin-fixed tissues from culture-negative ruminants. Vet Microbiol 87:15–23.[Medline]
  11. National Cancer Institute. 1982, Sponsored study of non-Hodgkins lymphomas: summary and description of a working formulation for clinical usage. Cancer 49:2112–2135.[Medline]
  12. Shultheiss P.C., Dolginow S.Z.: 1994, Granulomatous enteritis caused by Mycobacterium avium in a ferret. J Am Vet Med Assoc 204:1217–1218.[Medline]
  13. Valheim M., Dionne B., Heiene R., et al.: 2001, Disseminated Mycobacterium celatum (type 3) infection in a domestic ferret (Mustela putorius furo). Vet Pathol 38:460–463.[Abstract/Free Full Text]
  14. van Soolingen D., van der Zanden A.G., de Haas P.E., et al.: 1998, Diagnosis of Mycobacterium microti infections among humans by using novel genetic markers. J Clin Microbiol 36:1840–1845.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
jvdiHome page
S. D. Fitzgerald, D. G. Sledge, R. Maes, A. Wise, and M. Kiupel
Coinfection of a cow with Bovine leukemia virus and Mycobacterium bovis
J Vet Diagn Invest, November 1, 2009; 21(6): 878 - 882.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saunders, G. K.
Right arrow Articles by Thomsen, B. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saunders, G. K.
Right arrow Articles by Thomsen, B. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS