JVDI Advertisement
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Journal of Veterinary Diagnostic Investigation Vol. 21 Issue 5, 684-688
Copyright © 2009 by the American Association of Veterinary Laboratory Diagnosticians
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schissler, J. R.
Right arrow Articles by Gebreyes, W. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schissler, J. R.
Right arrow Articles by Gebreyes, W. A.

Brief Research Reports

Evaluation of Clinical Laboratory Standards Institute interpretive criteria for methicillin-resistant Staphylococcus pseudintermedius isolated from dogs

Jennifer R. Schissler1, Andrew Hillier, Joshua B. Daniels, Lynette K. Cole and Wondwossen A. Gebreyes

Correspondence: 1Corresponding Author: Jennifer R. Schissler, 601 Vernon L Tharp Street, Columbus, OH 43210. schissler.3{at}osu.edu


   Abstract
TOP
 Sources and manufacturers
 Abstract
References
 
The Clinical and Laboratory Standards Institute published in 2008 new interpretive criteria for the identification of methicillin resistance in staphylococci isolated from animals. The sensitivity of the 2008 interpretive criteria for mecA gene–positive Staphylococcus pseudintermedius, compared with the previous criteria of 2004, was investigated. Thirty clinical isolates of methicillin-resistant S. pseudintermedius from dogs were used. The presence of the mecA gene was determined by polymerase chain reaction. The minimum inhibitory concentration for oxacillin was determined by broth microdilution. The 2008 breakpoint of ≥4 µg/ml for methicillin resistance resulted in a diagnostic sensitivity of 73.3% (22/30). The 2004 breakpoint guideline of ≥0.5 µg/ml resulted in a diagnostic sensitivity of 97% (29/30). For oxacillin disk diffusion, the 2008 interpretive criterion of ≤10 mm for methicillin resistance resulted in a sensitivity of 70% (21/30). If intermediate isolates (11 or 12 mm) were considered resistant, the sensitivity was 93% (28/30). If intermediate isolates (11 or 12 mm) were considered resistant, the sensitivity was 93% (28/30). Application of the 2004 interpretive criterion of ≤17 mm resulted in a diagnostic sensitivity of 100% (30/30). For cefoxitin disk diffusion, the interpretive criterion of ≤21 mm for methicillin resistance (as used for Staphylococcus aureus) resulted in a diagnostic sensitivity of 6.7% (2/30). The interpretive criterion of ≤24 mm (as used for coagulase-negative staphylococci) resulted in a diagnostic sensitivity of 43.3% (13/30). With the use of 2008 interpretive criteria, all 3 tests produced what we consider to be an unacceptable level of false negative results. Our findings also suggest that cefoxitin disk diffusion is an inappropriate screening test for methicillin resistance of canine S. pseudintermedius.

Key Words: Dogs • methicillin • oxacillin • resistant • Staphylococcus pseudintermedius

Staphylococcus pseudintermedius, previously identified as Staphylococcus intermedius,9,10,20 is the most common etiologic agent in canine pyoderma21 and an agent commonly involved in canine otitis.17,22 Methicillin-resistant S. pseudintermedius (MRSP) has been increasingly reported as a primary pathogen in canine infections.2,12,13,19,23,24

All methicillin-resistant staphylococci are, by convention, regarded to be resistant to all β-lactam antibiotics in vivo.5,7 Cephalosporins are the most common antimicrobials used to treat S. pseudintermedius infections in dogs18 but are not efficacious for the treatment of MRSP infections. Thus, accurate determination of methicillin resistance is of critical importance to the clinician and the canine patient.

Methicillin resistance is imparted by penicillin-binding protein 2a (PBP2a), which is encoded by the gene mecA.15 The gold standard for diagnosis of methicillin resistance is detection of mecA via polymerase chain reaction (PCR).6,7

Veterinary microbiology laboratories rely on a variety of laboratory tests to identify methicillin resistance, and few laboratories at this time, if any, are known to perform PCR for mecA on a routine diagnostic basis. The most commonly used laboratory tests use oxacillin as a surrogate for methicillin in the following formats: broth microdilution (MIC), disk diffusion, and testing on oxacillin salt agar. Disk diffusion testing with the use of cefoxitin as a surrogate for oxacillin has also been suggested.7

The Clinical and Laboratory Standards Institute (CLSI) has published new (2008) performance standards for antimicrobial susceptibility testing of bacteria isolated from animals,7,8 and new interpretive criteria for the determination of oxacillin susceptibility and resistance in staphylococci were specified. The 2008 document states that Staphylococcus aureus interpretive criteria should be applied to the veterinary coagulase-positive staphylococci such as S. intermedius. The previous (2004) CLSI (formerly NCCLS) document recommended application of non–S. aureus Staphylococcus spp. interpretive criteria (coagulase-negative staphylococci criteria) to veterinary coagulase-positive staphylococci.14 The S. aureus and Staphylococcus spp. oxacillin interpretive criteria, as applied to veterinary coagulase-positive staphylococci, differ in MIC breakpoints and disk diffusion cut-off values. The S. aureus–based criteria, as recommended in 2008, consist of smaller disk diffusion inhibition zone diameters and greater MIC breakpoints than the 2004 Staphylococcus spp.–based criteria. Therefore, the 2008 criteria are a more stringent basis for the determination of oxacillin resistance in veterinary coagulase-positive staphylococci than the 2004 criteria.

Prompted by the release of the 2008 CLSI interpretive criteria, in this study, we investigated whether the new breakpoints would accurately detect oxacillin resistance in mecA-positive S. pseudintermedius isolated from canine patients at The Ohio State University Veterinary Teaching Hospital (Columbus, OH). The goal of this study was to compare the 2008 and 2004 CLSI interpretive criteria for identifying the oxacillin-resistant phenotype of PCR-confirmed, mecA-positive MRSP clinical isolates from dogs.

The specimens included in this study were selected from a pathogen data bank of clinical isolates collected from February 2007 to September 2008 from the clinical microbiology laboratory at the Veterinary Teaching Hospital at The Ohio State University. The bank included all isolates of coagulase-positive staphylococci that were suspected to be methicillin resistant on the basis of resistance or intermediate susceptibility to oxacillin on disk diffusion test and, in some instances, oxacillin salt agar testing. Subsequently, mecA PCR was performed on all banked isolates. Isolates were frozen at –80°C in trypticase soy broth and 20% dimethyl sulfoxide for up to 20 months and were prepared from a single colony.

The criteria used for selection of isolates included that each isolate 1) originated from a unique canine patient, 2) was associated with clinically apparent infection of the skin (wounds, lesions of pyoderma, incisions) or ear (external ear canal, middle ear), 3) was positive for mecA, and 4) was identified as S. pseudintermedius.

The isolates were subcultured from freezer storage and streaked onto trypticase soy agar supplemented with 5% sheep's blood.a One isolated colony was further subcultured for subsequent biochemical identification and susceptibility testing.

Reagents from commercial sources were used whenever possible for biochemical testing, and all incubations occurred at 35°C in ambient air. The coagulase testa was interpreted at 24 hr. Phenol-redb tests of trehalosec and lactosec fermentation were interpreted at 48 hr. Mannitol salt agara was used to assess fermentation of mannitol and was interpreted at 48 hr. The Voges–Proskauer testd was interpreted after 48 hr of incubation. Quality control strains S. intermedius ATCC (American Type Culture Collection) 29663, Staphylococcus schleiferi subsp. coagulans ATCC 49545, and S. aureus ATCC 8325 were included as controls for identification.

Microdilution testing for oxacillin MIC assessment was performed with Mueller–Hinton brothe supplemented with 5% NaCl. The MIC was determined for each isolate in a semiautomated system.f CLSI protocols and instrument manufacturer instructions were followed.

Bacteria were suspended in sterile, deionized water and adjusted to a 0.5 McFarland standard for Kirby–Bauer disk diffusion testing. Suspensions were swabbed onto Mueller–Hinton agara to make lawns, and disks containing oxacillin (1 µg) and cefoxitin (30 µg) were applied.a The plate was assessed after 24 hr of incubation at 35°C, and the zone of inhibition diameter for each antimicrobial disc was recorded in millimeters.

Isolates were evaluated for methicillin resistance using 2008 CLSI S. aureus–based interpretive criteria and 2004 Staphylococcus spp.–based criteria for oxacillin broth microdilution testing and Kirby–Bauer disk diffusion tests. Isolates were also evaluated on the cefoxitin disk diffusion test comparing the interpretive criteria used for S. aureus and coagulase-negative staphylococci (CNS; Table 1).


View this table:
[in this window]
[in a new window]

  		Table 1 Current (2008) and previous (2004) Clinical and Laboratory Standards Institute (CLSI) interpretive criteria for veterinary coagulase-positive staphylococci for oxacillin broth microdilution, oxacillin disk diffusion, and the 2008 cefoxitin disk diffusion interpretive criteria for coagulase-negative staphylococci (CNS) and Staphylococcus aureus.

 
Before DNA extraction for mecA PCR, isolates were subcultured in brain heart infusion broth. Genomic DNA was prepared with the use of a commercially available extraction kit per manufacturer instructions for Gram-positive bacteria.g The mecA PCR was performed with previously described primers:16 (mecA-F: TCCAGATTACAACTTCACCAGG and mecA-R: CCACTTCATATCTTGTAACG with an expected amplicon size of 162 base pairs). Included in all PCR reactions were positive ATCC 43300 methicillin-resistant S. aureus subsp. aureus and no template negative controls. Additional methicillin-susceptible staphylococcal controls—ATCC 49545, ATCC 29663, LMG 22221, ATCC 8325, ATCC 29523—were also performed. PCR reactions were performed with commercially available beads.h A final reaction volume of 25 µl with 1 µl of template DNA was used. Amplification was performed with a thermocycleri under the following conditions: initial denaturation at 95°C for 5 min followed by 30 cycles of 95°C for 1 min, 54°C for 1 min, 72°C for 1 min, and a final extension step of 72°C for 7 min. A 1% agarose gel was used for electrophoresis after staining with ethidium bromide. Gels were visualized under ultraviolet illumination.

Thirty isolates met all the criteria and thus were included in the study. All isolates were identified as S. pseudintermedius (previously S. intermedius in dogs) and were coagulase positive, VP negative, positive for fermentation of lactose and trehalose, and negative for fermentation of mannitol. The specific results and interpretation of each test for each isolate are presented in Table 2.


View this table:
[in this window]
[in a new window]

  		Table 2 Current (2008) and previous (2004) Clinical and Laboratory Standards Institute interpretive criteria results for oxacillin broth microdilution, oxacillin disk diffusion, and cefoxitin disk diffusion in mecA PCR-positive Staphylococcus pseudintermedius canine clinical isolates.

 
The 2008 breakpoint of ≥4 µg/ml for methicillin resistance resulted in a diagnostic sensitivity of 73.3% (22/30) for mecA-positive S. pseudintermedius. The 2004 breakpoint guideline of ≥0.5 µg/ml for methicillin resistance resulted in a diagnostic sensitivity of 97% (29/30). The 2008 CLSI interpretive guideline of ≤10 mm for methicillin resistance resulted in a diagnostic sensitivity of 70% (21/30) for mecA-positive S. pseudintermedius. If intermediate isolates (11- or 12-mm zone of inhibition) are considered resistant (as might occur in clinical interpretations), the diagnostic sensitivity was 93% (28/30). Application of the 2004 interpretive criterion of ≤17 mm for methicillin resistance in S. aureus resulted in a diagnostic sensitivity of 100% (30/30). The interpretive criterion of ≤21 mm for methicillin resistance (as used for S. aureus) resulted in a diagnostic sensitivity of 6.7% (2/30) for mecA-positive S. pseudintermedius.

The interpretive criterion of ≤24 mm for methicillin resistance (as used for coagulase-negative staphylococci) resulted in a diagnostic sensitivity of 43.3% (13/30).

The 2008 interpretive criteria failed to detect methicillin resistance in some clinical mecA-positive isolates of S. pseudintermedius from the skin and ears of dogs. The most sensitive method for phenotypic recognition of methicillin resistance in this limited cohort of mecA-positive S. pseudintermedius isolates was oxacillin Kirby–Bauer disk diffusion under the 2004 interpretive criteria, with 100% sensitivity; the 2008 criteria failed to identify 2 methicillin-resistant isolates. The 2008 interpretive criteria for oxacillin broth microdilution failed to identify methicillin resistance in 26.6% of isolates in this study. The 2004 interpretive criteria were more sensitive, although methicillin resistance was unrecognized in a single isolate (isolate 1).

Cefoxitin disk diffusion was the least sensitive method. Interpretive criteria specific for veterinary staphylococci, including S. pseudintermedius, remain to be established. Use of CNS and S. aureus interpretive guidelines in this cohort of isolates failed to identify methicillin resistance in 57.7% and 93.3% of isolates, respectively. This finding is consistent with a previous study,3 wherein the sensitivity of CNS interpretive criteria in PBP2a-positive S. intermedius was found to be 44% (9 isolates tested) and 17% (24 isolates tested). In contrast, cefoxitin disk diffusion has been reported to be 84.6–100% sensitive and 87.5–100% specific for mecA-positive and -negative human origin S. aureus, respectively.1,4 In a previous study,3 cefoxitin disk diffusion was 100% specific in 74 isolates with CNS interpretive criteria. Specificity could not be assessed in the work presented here because mecA-negative isolates were not evaluated. The use of cefoxitin disk diffusion for detecting the methicillin-resistant phenotype of S. pseudintermedius from dogs requires further investigation.

Isolate 1, though mecA-positive, was not identified as methicillin resistant with oxacillin broth microdilution 2004 nor 2008 interpretive criteria. Discordance between the presence of mecA and the absence of a corresponding oxacillin-resistant phenotype has been recognized previously in veterinary isolates of S. aureus, S. intermedius, and S. schleiferi,3 as well as human isolates of S. aureus.11 However, in isolate 1, methicillin resistance was detected via oxacillin disk diffusion (2004 and 2008 interpretive criteria) and via cefoxitin disk diffusion (2004 CNS interpretive criteria), which is consistent with a PBP2a-positive phenotype.

mecA-negative clinical isolates were not evaluated in this study. Therefore specificity and expectation for false positive results for these methods was not determined. A cohort of 44 mecA-negative canine S. pseudintermedius isolates was recently evaluated by Bemis et al. 2 The specificity of oxacillin broth microdilution was 99.4%, and 100% with 2004 and 2008 criteria, respectively.2

The superior sensitivity of the 2004 oxacillin Kirby–Bauer disk diffusion criteria was similarly demonstrated in 230 mecA-positive canine S. pseudintermedius isolates by Bemis et al.2 Oxacillin Kirby–Bauer disk diffusion resulted in a sensitivity of 99.1% and 85.1% with 2004 and 2008 criteria, respectively.2 Bemis et al.2 evaluated cefoxitin disk diffusion in 88 mecA-positive and 204 mecA-negative canine S. pseudintermedius isolates. Although highly specific (100%), the cefoxitin Kirby–Bauer disk diffusion method was also found to be the least sensitive method; sensitivities were 85.3% and 70.9% under 2004 and 2008 criteria, respectively.2

Of note, the diagnostic sensitivities for cefoxitin disk testing reported by Bemis et al. 2 (85.3% and 70.9%) are higher than that of the work presented here (6.7% and 43.3%). The reason for this difference is speculative and might reflect increased accuracy via larger cohort size of that study or regional strain differences. The study also did not restrict number of isolates included per patient; however, the frequency of such inclusions was not reported. Inclusion of concurrent or subsequent isolates from the same individual might have inadvertently selected for clonal isolates that were cefoxitin-sensitive. However, clonality is not restricted to the individual, and evaluation of clonality was not undertaken in this study, nor the study by Bemis et al.2 Despite this disagreement in sensitivity, the work presented here confirms the superior sensitivity of oxacillin Kirby–Bauer disk diffusion interpreted with 2004 CLSI criteria and the inferior sensitivity of cefoxitin disk diffusion in the evaluation of methicillin resistance in canine-origin S. pseudintermedius isolates in a geographically separate population.

With the use of 2008 interpretive criteria, all 3 test methods evaluated would have given what we consider to be an unacceptable level of false negative results, which could have led to inappropriate treatment if susceptibility to other β-lactam antibiotics was identified and reported in isolates falsely determined to be methicillin susceptible. Our study suggests that application of the 2004 CLSI criteria for oxacillin disk diffusion and oxacillin broth microdilution test produces superior sensitivity for the detection of methicillin-resistant S. pseudintermedius compared with the 2008 criteria. Furthermore, the findings presented here demonstrate that an unacceptably higher rate of false negative results occur with application of the 2008 CLSI criteria, consistent with the recent work published by Bemis et al.2 Therefore, it is advised that veterinary diagnostic laboratories abstain from using the 2008 CLSI criteria when evaluating methicillin resistance in canine S. pseudintermedius. The 2004 CLSI criteria for oxacillin Kirby–Bauer disk diffusion and oxacillin broth microdilution should be used to evaluate methicillin resistance in canine S. pseudintermedius isolates. In addition, our findings confirm that cefoxitin disk diffusion, regardless of CNS or S. aureus CLSI interpretive guidelines, is an inappropriate screening test for methicillin resistance in S. pseudintermedius isolated from dogs.


   Acknowledgments
 
The authors thank Narry Tiao and Jennifer Mathews for performing mecA PCR and Nancy Martin for assistance with antimicrobial susceptibility.


   Sources and manufacturers
TOP
 Sources and manufacturers
Abstract
 References
 
From the Departments of Veterinary Clinical Science (Schissler, Hillier, Daniels, Cole) and Veterinary Preventive Medicine (Gebreyes), The Ohio State University, Columbus, OH. Back

a. BD, Franklin Lakes, NJ. Back

b. Difco Laboratories Inc., Sparks, MD. Back

c. Sigma-Aldrich, St. Louis, MO. Back

d. Remel Inc., Lenexa, KS. Back

e. Trek Diagnostic Systems, Cleveland, OH. Back

f. Sensititre COMEQ3F panel, Trek Diagnostic Systems, Cleveland, OH. Back

g. Qiagen DNeasy® Blood and Tissue Kit, Qiagen Inc., Valencia, CA. Back

h. illustraTM puReTaqTM Ready-To-Go PCR Beads, GE Healthcare Technologies, Piscataway, NJ. Back

i. PTC-100 Programmable Thermal Controller, MJ Research Inc., Watertown, MA. Back


   References
TOP
 Sources and manufacturers
 Abstract
 References
 

  1. Baddour M.M., AbuElKheir M.M., Fatani A.J. 2007 Comparison of mecA polymerase chain reaction with phenotypic methods for the detection of methicillin resistant Staphylococcus aureus. Curr Microbiol 55 473 479.[Medline]
  2. Bemis D.A., Jones R.D., Frank L.A., et al. 2009 Evaluation of susceptibility test breakpoints used to predict mecA-mediated resistance in Staphylococcus pseudintermedius isolated from dogs. J Vet Diagn Invest 21 53 58.[Abstract/Free Full Text]
  3. Bemis D.A., Jones R.D., Hiatt L.E., et al. 2006 Comparison of tests to detect oxacillin resistance in Staphylococcus intermedius, Staphylococcus schleiferi, and Staphylococcus aureus isolates from canine hosts. J Clin Microbiol 44 3374 3376.[Abstract/Free Full Text]
  4. Bosgelmez-Tinas G., Ulusoy B., Aridogan F., Cosku-Ari F. 2006 Evaluation of different methods to detect oxacillin resistance in Staphylococcus aureus and their clinical laboratory utility. Eur J Clin Microbiol Infect Dis 25 410 412.[Medline]
  5. Brown D.F., Edwards D.I., Hawkey P.M., et al. 2005 Guidelines for the laboratory diagnosis and susceptibility testing of methicillin-resistant Staphylococcus aureus (MRSA). Joint Working Party of the British Society for Antimicrobial Chemotherapy; Hospital Infection Society; Hospital Infection Society; Infection Control Nurses Association. J Antimicrob Chemother 56 1000 1018.[Abstract/Free Full Text]
  6. Chambers H.F. 1997 Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 10 781 791.[Abstract/Free Full Text]
  7. Clinical and Laboratory Standards Institute (CLSI) 2008 Detection of methicillin resistant staphylococci, 3rd ed., approved standard M31-A3 CLSI Wayne, PA.
  8. Clinical and Laboratory Standards Institute (CLSI) 2008 Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, 3rd ed., approved standard M31-A3 CLSI Wayne, PA.
  9. Devriese L.A., Hermans K., Baele M., Haesebrouk F. 2009 Staphylococcus pseudintermedius versus Staphylococcus intermedius. Vet Microbiol 133 206 207.[Medline]
  10. Devriese L.A., Vancanneyt M., Baele M., et al. 2005 Staphylococcus pseudintermedius sp. nov., a coagulase-positive species from animals. Int J Syst Evol Microbiol 55 1569 1573.[Abstract/Free Full Text]
  11. Hososaka Y., Hanaki H., Endo H., et al. 2007 Characterization of oxacillin-susceptible mecA-positive Staphylococcus aureus: a new type of MRSA. J Infect Chemother 12 79 86.
  12. Loeffler A., Linek M., Moodley A., et al. 2007 First report of multiresistant, mecA-positive Staphylococcus intermedius in Europe: 12 cases from a veterinary dermatology referral clinic in Germany. Vet Dermatol 28 412 421.
  13. Morris D.O., Rook K.A., Shofer F.S., Rankin S.C. 2006 Screening of Staphylococcus aureus, Staphylococcus intermedius, and Staphylococcus schleiferi isolates obtained from small companion animals for antimicrobial resistance: a retrospective review of 749 isolates (2003–04). Vet Dermatol 17 332 337.[Medline]
  14. National Committee for Clinical Laboratory Standards (NCCLS) 2004 Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, informational supplement M31-S1 NCCLS Wayne, PA.
  15. Niemeyer D.M., Pucci M.J., Thanassi J.A., et al. 1996 Role of mecA transcriptional regulation in the phenotypic expression of methicillin resistance in Staphylococcus aureus. J Bacteriol 178 5464 5471.[Abstract/Free Full Text]
  16. Oliveira D.C., de Lencastre H. 2002 Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 46 2155 2161.[Abstract/Free Full Text]
  17. Oliveira L.C., Leite C.A., Brilhante R.S., Carvalho C.B. 2008 Comparative study of the microbial profile from bilateral canine otitis externa. Can Vet J 49 785 788.[Medline]
  18. Rantala M., Holso K., Lillas A., et al. 2004 Survey of condition based prescribing of antimicrobial drugs for dogs at a veterinary teaching hospital. Vet Rec 155 259 262.[Abstract/Free Full Text]
  19. Ruscher C., Lubke-Becker A., Wleklinski C.G., et al. 2008 Prevalence of methicillin-resistant Staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Vet Microbiol Epub ahead of print, PMID 19097710..
  20. Sasaki T., Kikuchi K., Tanaka Y., et al. 2008 Reclassification of phenotypically identified Staphylococcus intermedius strains. J Clin Microbiol 45 2770 2778.
  21. Scott D.W., Miller W.H., Griffin C.E. 2001 Bacterial skin disease. In: Muller and Kirk's dermatology, 6th ed. 274 335 WB Saunders Philadelphia, PA.
  22. Scott D.W., Miller W.H., Griffin C.E. 2001 Diseases of eyelids, claws, anal sacs, and ears. In: Muller and Kirk's dermatology, 6th ed. 1213 WB Saunders Philadelphia, PA.
  23. van Duijkeren E., Houwers D.J., Schoormans A., et al. 2008 Transmission of methicillin-resistant Staphylococcus intermedius between humans and animals. Vet Microbiol 128 213 215.[Medline]
  24. Zubeir I.E., Kanbar T., Alber J., et al. 2007 Phenotypic and genotypic characteristics of methicillin/oxacillin-resistant Staphylococcus intermedius isolated from clinical specimens during routine veterinary microbiological examinations. Vet Microbiol 121 170 176.[Medline]



This article has been cited by other articles:


Home page
 jvdiHome page
J. S. Slettemeas, J. Mikalsen, and M. Sunde
Further diversity of the Staphylococcus intermedius group and heterogeneity in the MboI restriction site used for Staphylococcus pseudintermedius species identification
J Vet Diagn Invest, September 1, 2010; 22(5): 756 - 759.
[Abstract] [Full Text] [PDF]

Home page
 jvdiHome page
M. G. Papich Vice Chair
Proposed changes to Clinical Laboratory Standards Institute interpretive criteria for methicillin-resistant Staphylococcus pseudintermedius isolated from dogs
J Vet Diagn Invest, January 1, 2010; 22(1): 160 - 160.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schissler, J. R.
Right arrow Articles by Gebreyes, W. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schissler, J. R.
Right arrow Articles by Gebreyes, W. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS